Los Angeles Pierce College Double Stranded DNA Questions

Help me study for my Biology class. I’m stuck and don’t understand.

a) Replicate this sense strand to create a double-stranded DNA helix

TCACCATGAAACTCACACCGGGGAAAACTCTTGCACTTATATTCTTGTTCAAGACCTAGTATAACACATTT


b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by finding the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon.


c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below

5’ UTR:

3’ UTR:

Calculate the price
Make an order in advance and get the best price
Pages (550 words)
$0.00
*Price with a welcome 15% discount applied.
Pro tip: If you want to save more money and pay the lowest price, you need to set a more extended deadline.
We know how difficult it is to be a student these days. That's why our prices are one of the most affordable on the market, and there are no hidden fees.

Instead, we offer bonuses, discounts, and free services to make your experience outstanding.
How it works
Receive a 100% original paper that will pass Turnitin from a top essay writing service
step 1
Upload your instructions
Fill out the order form and provide paper details. You can even attach screenshots or add additional instructions later. If something is not clear or missing, the writer will contact you for clarification.
Pro service tips
How to get the most out of your experience with MyhomeworkGeeks
One writer throughout the entire course
If you like the writer, you can hire them again. Just copy & paste their ID on the order form ("Preferred Writer's ID" field). This way, your vocabulary will be uniform, and the writer will be aware of your needs.
The same paper from different writers
You can order essay or any other work from two different writers to choose the best one or give another version to a friend. This can be done through the add-on "Same paper from another writer."
Copy of sources used by the writer
Our college essay writers work with ScienceDirect and other databases. They can send you articles or materials used in PDF or through screenshots. Just tick the "Copy of sources" field on the order form.
Testimonials
See why 20k+ students have chosen us as their sole writing assistance provider
Check out the latest reviews and opinions submitted by real customers worldwide and make an informed decision.
Human Resources Management (HRM)
excellent, great job
Customer 452773, June 19th, 2023
Criminal Justice
This has been the greatest help while I am recovering from an illness. Thank your team so much.
Customer 452671, May 2nd, 2021
BUSINESS LAW
excellent job made a 93
Customer 452773, March 22nd, 2023
BUSINESSADMINECO535
excellent work
Customer 452773, October 6th, 2023
Business Studies
Thank you very much for a good job done and a quick turn around time.
Customer 452615, March 31st, 2021
Social Work and Human Services
Great work I would love to continue working with this writer thought out the 11 week course.
Customer 452667, May 30th, 2021
Nursing
I just need some minor alterations. Thanks.
Customer 452547, February 10th, 2021
DATA565
The support team was late responding , my paper was late because the support team didn't respond in a timely manner. The writer of the paper finally got it right but seems there was a problem getting the revisioin to me.
Customer 452773, April 7th, 2024
ACC543MANAGERIALACCOUNTINGANDLEGALASPECTS
excellent
Customer 452773, January 25th, 2024
Management
Thank you!!! I received my order in record timing.
Customer 452551, February 9th, 2021
LEADERSHIP
excellent job
Customer 452773, August 12th, 2023
Business and administrative studies
Thank you for your hard work
Customer 452773, October 19th, 2023
11,595
Customer reviews in total
96%
Current satisfaction rate
3 pages
Average paper length
37%
Customers referred by a friend
OUR GIFT TO YOU
15% OFF your first order
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Claim my 15% OFF Order in Chat
Close

Sometimes it is hard to do all the work on your own

Let us help you get a good grade on your paper. Get professional help and free up your time for more important courses. Let us handle your;

  • Dissertations and Thesis
  • Essays
  • All Assignments

  • Research papers
  • Terms Papers
  • Online Classes
Live ChatWhatsApp